rosalind rna - transcribing dna to rna
"""
Rosalind RNA - Transcribing DNA into RNA
Problem
An RNA string is a string formed from the alphabet containing 'A', 'C', 'G',
and 'U'.
Given a DNA string t corresponding to a coding strand, its transcribed RNA
string u is formed by replacing all occurrences of 'T' in t with 'U' in u.
Given: A DNA string t having length at most 1000 nt.
Return: The transcribed RNA string of t.
Sample Dataset
GATGGAACTTGACTACGTAAATT
Sample Output
GAUGGAACUUGACUACGUAAAUU
"""
import fileinput
for row in fileinput.input('./rosalind_rna.txt'):
row = row.replace("T", "U")
print row