Cacher is the code snippet organizer for pro developers

"""
Rosalind RNA - Transcribing DNA into RNA

Problem

An RNA string is a string formed from the alphabet containing 'A', 'C', 'G',
and 'U'.

Given a DNA string t corresponding to a coding strand, its transcribed RNA
string u is formed by replacing all occurrences of 'T' in t with 'U' in u.

Given: A DNA string t having length at most 1000 nt.

Return: The transcribed RNA string of t.

Sample Dataset
GATGGAACTTGACTACGTAAATT

Sample Output
GAUGGAACUUGACUACGUAAAUU
"""

import fileinput

for row in fileinput.input('./rosalind_rna.txt'):
    row = row.replace("T", "U")
	print row